A teen stablehand who cheated death after a horrific high-speed fall left her waking from a coma in a “vegetative state” is ...
"With every step we took, we held on and prayed we would make it through to the next one," Alicia Claytor, 35, told Newsweek.
His wife has become his full-time carer and says - 'It's like having a young child' ...
Things continue to trend in the right direction for Brian Foster after his serious car accident May 1.
Mark Ludlow, 63, was assisting a colleague on a broken lift at a Staffordshire factory when a giant metal rod dropped and struck his face, leaving the couple surviving on just £1,300 a month in ...
Nervous system injuries span a wide clinical and biological spectrum, from traumatic brain injury and stroke to spinal cord ...
A man was left with permanent brain damage after a giant metal bar smashed onto his head while at work – leaving him and his wife surviving on just £1,300 a month. Electrician Mark Ludlow, 63, was ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results